A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
MINNESOTA, USA — The KARE 11 Weather Team has issued a Weather Impact Alert for Monday, June 29th. High temperatures are expected to climb into the middle and upper 90s with a possible heat index of ...
Even though flu season is ramping up, the real silent killer here at University of Wisconsin is academic fatigue. It may not give you a stuffy nose or a fever, but it’ll ruin your life just the same.
Some results have been hidden because they may be inaccessible to you
Show inaccessible results