Hidden Attribution Markers Found in Anthropic Claude Code Anthropic's AI model has been found to contain hidden tracking mechanisms targeting Chinese users within system prompts and code. Gabrielle ...
The accessibility tree decides whether an AI agent can read and act on your page. The 2026 data says the web is getting ...
OrcaRouter, the OpenAI-compatible LLM gateway, today published The AI Threat Report 2026 and made two of its security controls available at no cost to all users: the agent Firewall and input/output ...
Spread the love“`html 1. Understanding GZIP Compression GZIP compression is a technique that dramatically reduces the size of files sent from your web server to a user’s browser. This compression is ...
Backstage solved the portal problem, not the platform problem. A portal organizes catalogs, documentation, and templates. A ...
F5 fixes CVE-2026-42530 and CVE-2026-42055 in NGINX Open Source, addressing HTTP/3 and HTTP/2 flaws that could allow remote ...
Modern browsers let you share a link that jumps straight to whatever text you wish to highlight. Here’s how the feature works.
Morningstar Quantitative Ratings for Stocks are generated using an algorithm that compares companies that are not under analyst coverage to peer companies that do receive analyst-driven ratings.
A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
SpaceX is set to make history with a record-setting $1.77 trillion valuation at its IPO. The company had previously been expected to IPO at a valuation of as much as $2 trillion.
From reproductive rights to climate change to Big Tech, The Independent is on the ground when the story is developing. Whether it's investigating the financials of Elon Musk's pro-Trump PAC or ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results